Programmer needed small project perlemplois

Filtrer

Mes recherches récentes
Filtrer par :
Budget
à
à
à
Type
Compétences
Langues
    État du travail
    7,134 programmer needed small project perl travaux trouvés au tarif de EUR

    **Summary:** Need a custom perl (Open to PHP, or other language design) program designed that'll act as a shopping cart for my website, with versatile administrative capability. Have several specifications that I need that won't allow me to seek out and purchase a pre-designed package. Several things unique to my company, etc. It's nothing complex

    €279 (Avg Bid)
    €279 Offre moyenne
    12 offres

    This project is similar to one I have underway here currently(web client programming - search on 'dean'). I want to be able to navigate a password protected site and get and post to and from whatever pages I need. I can do this easily with my browser but am having either authentication problems with my scripts or perhaps since the dynamic pages are

    €112 (Avg Bid)
    €112 Offre moyenne
    6 offres
    Perl Code to restore User S'est terminé left

    ...MUST work without having to change security. MUST WORK with out having to loosen the permissions to file:666 and dir:777, My other webpage based adduser etc... solutions in perl are working fine, there is no reason for this one not to also. 4.) Only one user name has to be entered at a time. Only the user name is required. No password will be entered

    €41 (Avg Bid)
    €41 Offre moyenne
    2 offres
    Help with perl script S'est terminé left

    Need help to make this script receive user name from a web page and restore their access. [se connecter pour voir l'URL] ## Deliverables Complete source code of all programming work done

    €41 (Avg Bid)
    €41 Offre moyenne
    7 offres
    php perl programmer S'est terminé left

    We are currently looking for PHP and Perl programmers who have had working commercial experience specifically related to site tracking, search engines and marketing projects. LONDON AREA ONLY Please send CV and any examples of work to: [se connecter pour voir l'URL]@[se connecter pour voir l'URL]

    €176 - €265
    Scellé
    €176 - €265
    0 offres
    php perl programmer S'est terminé left

    We are currently looking for PHP and Perl programmers who have had working commercial experience specifically related to site tracking, search engines and marketing projects. Please send CV and any examples of work to: [se connecter pour voir l'URL]@[se connecter pour voir l'URL]

    €176 - €265
    Scellé
    €176 - €265
    0 offres
    Perl Database S'est terminé left

    ...designed in perl which has the following features. Members login: one for guest:guest, one for paid members which they will create login:pass. All information for paid members will be stored on file and retrieved when login. No information, no anything, is saved for guest:guest users. When they login to either script, they will be able to use a perl-based

    €35 (Avg Bid)
    €35 Offre moyenne
    7 offres

    ...probably a 10 minute job for the right person, but that person is not me. All I need to do is get the dynamic html of a site... thats it. I can do it easily with a browser but my perl script won't yet do the job. The site is https, requires a login and uses cookies/session key. The content is generated from a database (sql?) and is specific to my login. I

    €51 (Avg Bid)
    €51 Offre moyenne
    3 offres
    Perl Forum Hacks Needed S'est terminé left

    Hi; I need a Perl coder/coders for some MODs I need done to a perl forum script. The actual program is UltraBoard 2000 2.23, which should be fairly generic code for any perl programmer. I can live with most of the out-of-package features, but there are specific mods that I would like. You can get a better idea by checking out my board at: http://207

    €94 (Avg Bid)
    €94 Offre moyenne
    2 offres

    ...basic Web based Project Managment Application. This must be completed using Perl or PHP with MySQL. Required features: Admin page: Allows you to view, create, delete projects. (When creating a new project, a new directory must be made in the root web dir and all files for project placed in the newly created dir. When deleting a project all files and directorie...

    €107 (Avg Bid)
    €107 Offre moyenne
    10 offres
    AOL mail from perl script S'est terminé left

    Send / Recieve mail directly from AOL servers using perl and linux. I provide Example Files: [se connecter pour voir l'URL] contains 10 aol usernames (ScreenNames) one per line delimited by newlines. [se connecter pour voir l'URL] contains a 300 Char Text Message. you will create: [se connecter pour voir l'URL] a simple perl script that is easy to read and modify senda...

    €88 - €441
    €88 - €441
    0 offres
    Displaying filesize in PERL S'est terminé left

    Hello, I wish to display the filesize next to each file printed in the array below Please note - the 2 array symbols are now an astrisk to allow me to send this email here at rent a coder.... I tried $ENV{'CONTENT_LENGTH'}hoping to do just that but had no luck? I would be gratefull if one of you pro's could help me add this tid bit to my view sub below, so that I may learn what I wa...

    €13 (Avg Bid)
    €13 Offre moyenne
    3 offres

    Hello! I wish to display the filesize next to each file printed in the array below Please note - the 2 array symbols are now an astrisk to allow me to send this email here at rent a coder.... I tried $ENV{'CONTENT_LENGTH'}hoping to do just that but had no luck? I would be gratefull if one of you pro's could help me add this tid bit to my view sub below, so that I may learn what I wa...

    max €4
    Perl CGI Projects S'est terminé left

    Hello, We are currently looking for Perl programmers to help develop open source and commercial CGI products. You must have reasonable knowledge in any of the following areas: Perl Javascript Advanced HTML We would prefer it if you had previous experience at programming full products but it is not required. Programmers would benefit from a profit share

    €176 - €265
    Scellé
    €176 - €265
    0 offres

    a script in either php or perl with mysql that's a clone of [se connecter pour voir l'URL] with all thier features ## Deliverables Complete source code of all programming work done proof that it works

    €1447 (Avg Bid)
    €1447 Offre moyenne
    5 offres
    Perl mysql mass mailer S'est terminé left

    I need a script that will pull email addresses and names from a mysql file and mass mail to 1000's of people which works in the backgroud with a confirmation after the mailing to let me know that it is done ## Deliverables The code must include a htlp form in which to enter the subject, body and from email address beofre sending the mailing. The mysql file is already in use and this script...

    €60 (Avg Bid)
    €60 Offre moyenne
    5 offres
    PERL SCRIPT TWEAKS S'est terminé left

    Hello, I am new at PERL and over the last month have produced a script to help me organize a single users data. Two things still need to be fixed. 1. The script is processing "" semi quotes and such entered in on the edit form. (This is currently hardcoded and simply opens a text file and overwrites it) How can I prevent this from occuring? 2. My showdates

    €19 (Avg Bid)
    €19 Offre moyenne
    2 offres
    Genetics program in Perl S'est terminé left

    I need a program that starts with two parents parent1:TCGAGTGCCTCGATGACTAT parent2:GTTTTGGCAACAATGTAGGG This program should use a random method of choosing between crossover,mutation, and reporduction. Reproduction just simply compies the genetic code to the two children. Mutation basically mutates the genes and crossover, take half the genes, splits them and then combines them with the other chil...

    €127 (Avg Bid)
    €127 Offre moyenne
    4 offres
    Perl Picture Thumbnailer S'est terminé left

    I have a perl script that I bought (Over a year ago.) to do a thumbnail gallery and included in the program was a picture thumbnailer. I need to get the picture thumbnailer setup as a separate program that I can use on other websites. What it does? I place any number of full sized pictures into a folder on the server. The cgi script goes out and grabs

    €22 (Avg Bid)
    €22 Offre moyenne
    1 offres

    ...conversion of two C programs into two Perl based CGI scripts which will be invoked by either the HTTP “get” or “post” method. The C programs have two or so other C programs (and a header file) that they are dependant on. A number of the functions in these supporting C programs also need to converted into the appropriate Perl functions/modules to provide exactly

    €176 - €265
    Scellé
    €176 - €265
    0 offres
    Perl Upload.cgi S'est terminé left

    Need to transfer a unix - script to an win2000 machine. It`s an upload script. ## Deliverables The script must be checked - and then changed to work on a win2000 server. 1 function must be removed from the script. Please contact me for a copy of the file. ## Deadline information Only 320 lines of code for review. i think for an professional should be 10 min. work.

    €77 (Avg Bid)
    €77 Offre moyenne
    8 offres
    Perl Trainer Wanted S'est terminé left

    Possible week long training in London. Please e-mail with day rates etc.

    €176 - €265
    Scellé
    €176 - €265
    0 offres

    Wanted hardcore serious experieced PERL programmers who should possess good OOP knowledge. Preference would be given to the people familiar with some of the important PERL modules. CGI programming knowledge is a plus. Contact without CV mentioning total years of experience and nationality. Location is UK/EU. Foreign nationals [se connecter pour voir l'URL] azsx109@onebox

    €176 - €265
    Scellé
    €176 - €265
    0 offres
    Perl Script Modifications S'est terminé left

    We require a freelance programmer to make small modifications to an ‘off the shelf’ perl script. Working remotely, in your own time our requirements are as follows: 1. Once the customer has placed the product(s) in to the basket, the final page, which collects the customer information, will be located on a remote secure server ([se connecter pour voir l'URL]) We

    €176 - €265
    Scellé
    €176 - €265
    0 offres

    [se connecter pour voir l'URL]

    €176 - €265
    Scellé
    €176 - €265
    0 offres
    Perl CGI Script Needed S'est terminé left

    Hi, I need a perl cgi script made. Basically, the perl script will verify a list of email addresses, and save the valid ones to a text file. I have found a perl module at [se connecter pour voir l'URL] that I think does this. What I am wanting is for someone to take this module, or make their own, and provide to me a fully-functioning script, ready

    €176 - €265
    Scellé
    €176 - €265
    0 offres
    Perl Development S'est terminé left

    We need to have a script built that will take information supplied in a form and then build a HTML page automatically into the correct directory structure on our servers. Would be interested in hearing from anyone that thinks they can do this. I very good example is NetCard located at [se connecter pour voir l'URL]

    €176 - €265
    Scellé
    €176 - €265
    0 offres

    We are looking for a "low cost" CGI/Perl programmer to do two projects which may involve hacking existing scripts. Our budget is very limited, however, we are prepared to off-set the difference with advertising on our site including free job/project referrals. [se connecter pour voir l'URL] will soon begin helping businesses and individuals find, compare and se...

    €176 - €265
    Scellé
    €176 - €265
    0 offres
    PHP/Perl Developer S'est terminé left

    ...year old South West London (Kingston upon Thames) London UK based Internet Consultancy specialising in small to large company Web Sites, due to expansion are seeking an experienced Lead/Senior Programmer to compliment our existing team. 2 x Perl, PHP, MYSQL developers with experience for programming for database dynamic driven E-commerce Web Sites

    €176 - €265
    Scellé
    €176 - €265
    0 offres
    Perl freelancer, UK South S'est terminé left

    Hi We have a requirement for a perl contrator to do some 'polishing' to existing code and to create some new modules. This person needs to based in the UK, either in Hampshire or Berkshire. The following skills are ideal: Perl, Unix, CGI Please drop me a mail or call for a chat on: 01256 411344 07989 140124 Thanks! Mark Hughes [se connecter pour voir l'URL]

    €176 - €265
    Scellé
    €176 - €265
    0 offres
    Perl expert required S'est terminé left

    We require an individual with good, quality experience and skills working with perl and the CGI environment. In particular a full understanding of mod_perl and related performance issues and techniques. Work will involve design, migration and tuning of existing and new systems.

    €176 - €265
    Scellé
    €176 - €265
    0 offres
    Perl CM system S'est terminé left

    Hi We urgently require a experienced Perl programmer, to build a relatively simple Content Management System (mostly news articles) and a user database (access by username and password). We need someone to come in for a brief Wednesday 20th AM !! Please call JM Littman 0207 596 6700

    €176 - €265
    Scellé
    €176 - €265
    0 offres

    I've been asked to develop the front end on a messaging site that will be wap enabled. If I'm going to take it on I need a good perl person to work with. You will be experienced with URLs of database driven sites using PHP/perl in your portfolio. If you know XML too I'll be particularly interested. For details of the job send in your skillset, URLs

    €176 - €265
    Scellé
    €176 - €265
    0 offres
    basic perl script S'est terminé left

    I'm looking for a freelance programmer to write me a form and a script. For an idea of what I'd like to achieve, take a look at the following page on [se connecter pour voir l'URL] by phillip greenspun; [se connecter pour voir l'URL] Scroll down the page a bit and you can see the readers comments. Phillip gives away the software that runs his site for free, but all

    €176 - €265
    Scellé
    €176 - €265
    0 offres