Programmer needed small project perlemplois

Filtrer

Mes recherches récentes
Filtrer par :
Budget
à
à
à
Type
Compétences
Langues
    État du travail
    7,159 programmer needed small project perl travaux trouvés au tarif de EUR

    I have a web site with one small perl script on the first page. My URL is at http://a-work-from-home-opportunity.com. This web site has two seperate stores in it (to begin with). When a visitor to the web site clicks on the image of a walking man on the left side of the screen, he will forwarded to the home page of one of the stores. When the next person

    €45 (Avg Bid)
    €45 Offre moyenne
    13 offres
    CUSTOM Perl Script S'est terminé left

    What I need is a CUSTOM Perl script. I say custom because I don't want a completely cheap and cheesy script like all the other crap I've downloaded. Basically, it will be a script that takes a form, and submits the data as an email, but through a specified template which is specified as a hidden field. Please see the attached documentation for complete

    €61 (Avg Bid)
    €61 Offre moyenne
    12 offres
    Perl IP Spoofer S'est terminé left

    I need a Perl script written for me that will "spoof" IP addresses from a text file list. It will be used for legal testing purposes. The script will access a web page with the fake information, making the web server think that the IP is the spoofed IP. I also need the browser/OS "faked", which is much easier. This project needs to be finished ASAP

    €45 (Avg Bid)
    €45 Offre moyenne
    3 offres

    Need the following client frontend and perl code modifications for an autoresponder service. Currently using Maxsponder autoresponder software. This is setup on a pentium 3 1 GHz dedicated server running Redhat 6.2 and MySql software. Webmin is installed. The service IS NOT LIVE so there is no worry about crashing a live site or corrupting existing

    €486 (Avg Bid)
    €486 Offre moyenne
    2 offres
    Easy $$$ for PERL Expertise S'est terminé left

    ...pages of your views, opinions and expertise on the PERL programming language/development platform that follow the outline provided. All content must be original and copyright-capable. Please see attached requirements. ## Deliverables Complete proofread, spellchecked documents according to project requirements document. Complete copyrights to all work

    €38 (Avg Bid)
    €38 Offre moyenne
    4 offres

    ...SexRaven.com. To protect the token galleries from being bookmarked and returned to once the customer has dropped their tokens to view them, we need to install the Perl Police script. Perl Police will re-direct viewers to the token gate if they return to a bookmarked gallery, and will also set a limit on the time spent viewing the gallery. This is script

    N/A

    ...party processor provides a validation script in both Perl and C code, but I use ASP and they cannot offer me any help with this. I have never used Perl or C so I don't understand the code. I need this validation script converted to ASP. Here is the page with the instructions and the scripts for using Perl and C: [se connecter pour voir l'URL] Can anyone

    €15 (Avg Bid)
    €15 Offre moyenne
    2 offres

    I need a fully functioning Instant messaging program. Windows clients and a perl prog running to control the server and DB keeping track of IPs/Offline users/Online users etc. ## Deliverables Complete and fully-functional working program(s) in executable form as well as complete source code of all work done. Complete copyrights to all work purchased

    €223 (Avg Bid)
    €223 Offre moyenne
    5 offres

    ** BE AWARE! ** Looks like somebody want to order some mail abuse software, want to use mail gateway list, misconfigured proxy lists and random subjects for spam sending. btw: such kind of software even not allowed on eBay. ## Deliverables nothing....

    €440 - €4399
    €440 - €4399
    0 offres
    cgi perl mailer S'est terminé left

    I have two different scripts that need to be evaluated NOTE: Before you place your bid, please be assured that these are legitimate products for a legitimate email distribution provider. We have been called upon to distribute large opt-in business lists -- and prefer the flexibility of a server based utility such as this one. ZIPS will be provided to you of each application. SCRIPT # 1 - CGI-based...

    €384 (Avg Bid)
    €384 Offre moyenne
    7 offres

    I'm looking for someone interested in providing the scripting needed for the functionality of a fantasy/horror website. Commenting/Rating system, BBS. Preferably in Perl. Non-profit project - no ability to offer payment. However, might lead to future contracts for a talented coder. I am willing to do webdesign/graphic work in exchange

    €176 - €264
    Scellé
    €176 - €264
    0 offres

    Hi, thanks for looking! I had previously posted a project on this site, and due to limitations with my outsourcing company, the project has changed in scope and design. You are bidding on programming in PHP/Perl/CGI for 2 websites. Please give me the price for both. I do not want to assign both projects to separate people. Site #1: A dating/professional

    €528 (Avg Bid)
    €528 Offre moyenne
    1 offres
    84095 Editing a perl script S'est terminé left

    I have a script that checks stats then makes calculations based on a table of numbers stored in a .txt file. This is all completed and ...working fine. All I need is to add a feature so that I can specify different tables for user names. This should be more then 0.5-1 hours work for an experienced perl programmer. This project is urgent. Thank you.

    €13 (Avg Bid)
    €13 Offre moyenne
    1 offres
    84097 Perl Script S'est terminé left

    Script using cgi to search public database from our site.

    €79 (Avg Bid)
    €79 Offre moyenne
    1 offres
    A Perl Scrip S'est terminé left

    I currently have a perl scrip that needs some work. It suppose to work like this- 1- user enters in 7 or 8 data fields on a html form. 2- script creates a .txt file that is "." delimeted on the server. 3-script checks the date of the first record in the file and if it is older than a week- the file is emailed, backed up then deleted. 4-email is sent

    €26 (Avg Bid)
    €26 Offre moyenne
    9 offres
    Adding WML to Perl scripts S'est terminé left

    ...relationships with programmers who have extensive experience with Perl and XML/WML. It would also be beneficial to have experience with as much of the following as possible: Java servlets, C/C++, MySQL, SQL, Unix, NT, Apache, and IIS. The following project however initially requires Perl and XML/WML, with later projects requiring the rest. We also have

    €88 - €440
    €88 - €440
    0 offres

    I need 3 scripts with this features : -Simple user registration (name,lastname, country ,url, email, password) Create a single ID for each user. Save this to a ...so in the example if the user pay the database may look like : ID|name lastname|country|url|email|password|43 43 = 13 + 30 for paying The job is very simple for any perl programmer

    €70 (Avg Bid)
    €70 Offre moyenne
    1 offres
    Perl Submission Script S'est terminé left

    I need a website submiss...Description, Keywords, etc. SCREEN3:The user picks the search engines they wish to submit to. SCREEN4:Results page for each search engine chosen in a pass:fail format. Must be done in perl. ## Deliverables Complete and fully-functional working program(s) in executable form as well as complete source code of all work done.

    €30 (Avg Bid)
    €30 Offre moyenne
    10 offres
    PERL & WEBADVERTS S'est terminé left

    The work involves adapting and extending some existing perl scripts and developing new scripts if necessary to an existing website. Please see the attached doc for details. ## Deliverables Fully functioning website as per the attached specs.

    €226 (Avg Bid)
    €226 Offre moyenne
    6 offres
    PERL Modification S'est terminé left

    ...[se connecter pour voir l'URL] #hits #hits At the end of each url being searched I want it to add ALL the hits it finds and place that in a category that says TOTAL. When accepted to do this project you will better see what I mean. Please post questions, comments, and price quotes. Thanks. Aaron ## Deliverables Complete and fully-functional working program(s) in executable

    €20 (Avg Bid)
    €20 Offre moyenne
    4 offres
    C++ and Perl homework help S'est terminé left

    ...write some simple C++ and Perl programs as the deliverables describes. These programs will need to compile and run in an Unix environment. ## Deliverables Complete and fully-functional working program(s) in executable form as well as complete source code of all work done. !!LOOK BELOW!! Write a program (in C/C++ or perl) to simulate the busy-wait

    €39 (Avg Bid)
    €39 Offre moyenne
    2 offres

    We run slackware 7.1 kernel 2.4.5 Need to have perl script to work with single entry form page. Must be able to work with current configuration. Must work with out having to change permission in /etc. script and form is at the floowing URL. [se connecter pour voir l'URL] [se connecter pour voir l'URL] Thanks

    €24 (Avg Bid)
    €24 Offre moyenne
    3 offres
    Modify Perl Script (Again) S'est terminé left

    Need to have the script at the link below modified to accept one user name from a 1 field form and restore their access. [se connecter pour voir l'URL] Thanks Bob Ross ## Deliverables Complete and fully-functional working program(s) in executable form as well as complete source code of all work done.

    €9 (Avg Bid)
    €9 Offre moyenne
    1 offres
    Modify perl script S'est terminé left

    Need to have perl code that is used to send email from a web page modified. Instead of the code using the [se connecter pour voir l'URL] file for the names of the users to send to, we want the code to read the /etc/passwd file for the users to send to. With the [se connecter pour voir l'URL] file for those not to send an email to like root, etc.. or other users that don&...

    €46 (Avg Bid)
    €46 Offre moyenne
    18 offres

    ...programing languages: PHP, Perl, awk, bash, sed ( I know sed is nota programing language, but must be included in the project :)) ) The application could be anything you want, a message board, a bug tracker system, an e-commerce site, anything, but It should be simple, and clean. No RMDBS, JavaScript nor special HTML/Web Desing is needed, this application is

    €87 (Avg Bid)
    €87 Offre moyenne
    2 offres

    **Summary:** Need a custom perl (Open to PHP, or other language design) program designed that'll act as a shopping cart for my website, with versatile administrative capability. Have several specifications that I need that won't allow me to seek out and purchase a pre-designed package. Several things unique to my company, etc. It's nothing complex

    €278 (Avg Bid)
    €278 Offre moyenne
    12 offres

    This project is similar to one I have underway here currently(web client programming - search on 'dean'). I want to be able to navigate a password protected site and get and post to and from whatever pages I need. I can do this easily with my browser but am having either authentication problems with my scripts or perhaps since the dynamic pages are

    €112 (Avg Bid)
    €112 Offre moyenne
    6 offres
    Perl Code to restore User S'est terminé left

    ...MUST work without having to change security. MUST WORK with out having to loosen the permissions to file:666 and dir:777, My other webpage based adduser etc... solutions in perl are working fine, there is no reason for this one not to also. 4.) Only one user name has to be entered at a time. Only the user name is required. No password will be entered

    €40 (Avg Bid)
    €40 Offre moyenne
    2 offres
    Help with perl script S'est terminé left

    Need help to make this script receive user name from a web page and restore their access. [se connecter pour voir l'URL] ## Deliverables Complete source code of all programming work done

    €40 (Avg Bid)
    €40 Offre moyenne
    7 offres
    php perl programmer S'est terminé left

    We are currently looking for PHP and Perl programmers who have had working commercial experience specifically related to site tracking, search engines and marketing projects. LONDON AREA ONLY Please send CV and any examples of work to: [se connecter pour voir l'URL]@[se connecter pour voir l'URL]

    €176 - €264
    Scellé
    €176 - €264
    0 offres
    php perl programmer S'est terminé left

    We are currently looking for PHP and Perl programmers who have had working commercial experience specifically related to site tracking, search engines and marketing projects. Please send CV and any examples of work to: [se connecter pour voir l'URL]@[se connecter pour voir l'URL]

    €176 - €264
    Scellé
    €176 - €264
    0 offres
    Perl Database S'est terminé left

    ...designed in perl which has the following features. Members login: one for guest:guest, one for paid members which they will create login:pass. All information for paid members will be stored on file and retrieved when login. No information, no anything, is saved for guest:guest users. When they login to either script, they will be able to use a perl-based

    €35 (Avg Bid)
    €35 Offre moyenne
    7 offres

    ...probably a 10 minute job for the right person, but that person is not me. All I need to do is get the dynamic html of a site... thats it. I can do it easily with a browser but my perl script won't yet do the job. The site is https, requires a login and uses cookies/session key. The content is generated from a database (sql?) and is specific to my login. I

    €51 (Avg Bid)
    €51 Offre moyenne
    3 offres
    Perl Forum Hacks Needed S'est terminé left

    Hi; I need a Perl coder/coders for some MODs I need done to a perl forum script. The actual program is UltraBoard 2000 2.23, which should be fairly generic code for any perl programmer. I can live with most of the out-of-package features, but there are specific mods that I would like. You can get a better idea by checking out my board at: http://207

    €93 (Avg Bid)
    €93 Offre moyenne
    2 offres

    ...basic Web based Project Managment Application. This must be completed using Perl or PHP with MySQL. Required features: Admin page: Allows you to view, create, delete projects. (When creating a new project, a new directory must be made in the root web dir and all files for project placed in the newly created dir. When deleting a project all files and directorie...

    €106 (Avg Bid)
    €106 Offre moyenne
    10 offres
    AOL mail from perl script S'est terminé left

    Send / Recieve mail directly from AOL servers using perl and linux. I provide Example Files: [se connecter pour voir l'URL] contains 10 aol usernames (ScreenNames) one per line delimited by newlines. [se connecter pour voir l'URL] contains a 300 Char Text Message. you will create: [se connecter pour voir l'URL] a simple perl script that is easy to read and modify senda...

    €88 - €440
    €88 - €440
    0 offres
    Displaying filesize in PERL S'est terminé left

    Hello, I wish to display the filesize next to each file printed in the array below Please note - the 2 array symbols are now an astrisk to allow me to send this email here at rent a coder.... I tried $ENV{'CONTENT_LENGTH'}hoping to do just that but had no luck? I would be gratefull if one of you pro's could help me add this tid bit to my view sub below, so that I may learn what I wa...

    €13 (Avg Bid)
    €13 Offre moyenne
    3 offres

    Hello! I wish to display the filesize next to each file printed in the array below Please note - the 2 array symbols are now an astrisk to allow me to send this email here at rent a coder.... I tried $ENV{'CONTENT_LENGTH'}hoping to do just that but had no luck? I would be gratefull if one of you pro's could help me add this tid bit to my view sub below, so that I may learn what I wa...

    max €4
    Perl CGI Projects S'est terminé left

    Hello, We are currently looking for Perl programmers to help develop open source and commercial CGI products. You must have reasonable knowledge in any of the following areas: Perl Javascript Advanced HTML We would prefer it if you had previous experience at programming full products but it is not required. Programmers would benefit from a profit share

    €176 - €264
    Scellé
    €176 - €264
    0 offres

    a script in either php or perl with mysql that's a clone of [se connecter pour voir l'URL] with all thier features ## Deliverables Complete source code of all programming work done proof that it works

    €1443 (Avg Bid)
    €1443 Offre moyenne
    5 offres
    Perl mysql mass mailer S'est terminé left

    I need a script that will pull email addresses and names from a mysql file and mass mail to 1000's of people which works in the backgroud with a confirmation after the mailing to let me know that it is done ## Deliverables The code must include a htlp form in which to enter the subject, body and from email address beofre sending the mailing. The mysql file is already in use and this script...

    €60 (Avg Bid)
    €60 Offre moyenne
    5 offres
    PERL SCRIPT TWEAKS S'est terminé left

    Hello, I am new at PERL and over the last month have produced a script to help me organize a single users data. Two things still need to be fixed. 1. The script is processing "" semi quotes and such entered in on the edit form. (This is currently hardcoded and simply opens a text file and overwrites it) How can I prevent this from occuring? 2. My showdates

    €18 (Avg Bid)
    €18 Offre moyenne
    2 offres
    Genetics program in Perl S'est terminé left

    I need a program that starts with two parents parent1:TCGAGTGCCTCGATGACTAT parent2:GTTTTGGCAACAATGTAGGG This program should use a random method of choosing between crossover,mutation, and reporduction. Reproduction just simply compies the genetic code to the two children. Mutation basically mutates the genes and crossover, take half the genes, splits them and then combines them with the other chil...

    €127 (Avg Bid)
    €127 Offre moyenne
    4 offres
    Perl Picture Thumbnailer S'est terminé left

    I have a perl script that I bought (Over a year ago.) to do a thumbnail gallery and included in the program was a picture thumbnailer. I need to get the picture thumbnailer setup as a separate program that I can use on other websites. What it does? I place any number of full sized pictures into a folder on the server. The cgi script goes out and grabs

    €22 (Avg Bid)
    €22 Offre moyenne
    1 offres

    ...conversion of two C programs into two Perl based CGI scripts which will be invoked by either the HTTP “get” or “post” method. The C programs have two or so other C programs (and a header file) that they are dependant on. A number of the functions in these supporting C programs also need to converted into the appropriate Perl functions/modules to provide exactly

    €176 - €264
    Scellé
    €176 - €264
    0 offres
    Perl Upload.cgi S'est terminé left

    Need to transfer a unix - script to an win2000 machine. It`s an upload script. ## Deliverables The script must be checked - and then changed to work on a win2000 server. 1 function must be removed from the script. Please contact me for a copy of the file. ## Deadline information Only 320 lines of code for review. i think for an professional should be 10 min. work.

    €77 (Avg Bid)
    €77 Offre moyenne
    8 offres
    Perl Trainer Wanted S'est terminé left

    Possible week long training in London. Please e-mail with day rates etc.

    €176 - €264
    Scellé
    €176 - €264
    0 offres

    Wanted hardcore serious experieced PERL programmers who should possess good OOP knowledge. Preference would be given to the people familiar with some of the important PERL modules. CGI programming knowledge is a plus. Contact without CV mentioning total years of experience and nationality. Location is UK/EU. Foreign nationals [se connecter pour voir l'URL] azsx109@onebox

    €176 - €264
    Scellé
    €176 - €264
    0 offres
    Perl Script Modifications S'est terminé left

    We require a freelance programmer to make small modifications to an ‘off the shelf’ perl script. Working remotely, in your own time our requirements are as follows: 1. Once the customer has placed the product(s) in to the basket, the final page, which collects the customer information, will be located on a remote secure server ([se connecter pour voir l'URL]) We

    €176 - €264
    Scellé
    €176 - €264
    0 offres

    [se connecter pour voir l'URL]

    €176 - €264
    Scellé
    €176 - €264
    0 offres